Article Test

Introduction
Cystic fibrosis (CF) is a severe inherited disease due to mutations in the gene that codifies for the CF transmembrane conductance regulator (CFTR), a channel that mainly conducts chloride but that is also involved in maintaining transmembrane flow of bicarbonate, sodium and potassium. It is present in several human cells and different kind of mutations determine different CFTR defects. These defects are grouped in seven different classes that can be the target for different therapeutic strategies. Respiratory disease due to lung damage is the most severe and frequent manifestation, with chronic sino- pulmonary infections and acute exacerbations 1,2. Dysfunction in electrolytic transport produces an increased viscosity of mucus and a decreased muco- ciliary clearance, making microbial colonisation easier 1,3.

Some microbial species preferentially colonises lungs of patients with CF since childhood. The microbiota has been changing over the years, probably due to the use of different therapeutic approaches. By the age of 5 years more than half patients are colonised with Staphylococcus aureus and less than 30% also carry other respiratory pathogens (Haemophilus influenzae, Stenotrophomonas maltophilia, Achromobater spp., Burkholderia cepacia). Later, Pseudomonas aeruginosa appears and becomes predominant 4,5. From 2003, a change in the frequency of pathogens has been observed, with a marked increase of S. aureus and S. maltophilia and a concomitant increase in antimicrobial resistance (multi-drug resistant P. aeruginosa, methicillin- resistant S. aureus) 6 .

In CF, lungs constitute a heterogeneous environment where aerobic zones coexist with anaerobic zones generated by bronchial obstruction due to mucus plugs. P. aeruginosa initially colonises the mucosa producing intermittent infections, but promptly adapts to the environment by forming biofilms. At this stage infections become chronic and the bacterium is almost impossible to eradicate 7. Biofilms are organised communities of microorganisms composed of one or several species covered with a polymeric hydrated matrix of polysaccharides, proteins and nucleic acids of their own synthesis. This matrix is called extracellular polymeric substances (EPS) or extracellular matrix (ECM) and is a key element in the development of complex, three- dimensional, attached communities 8,9. Within biofilms bacteria become more resistant to the action of immune system and to chemical agents such as antibiotics 8,10. Two phenomena related to antibiotics action can develop: resistance and tolerance 11. Growth in the biofilms leads to phenotypic and genotypic diversity in a short time 3,7,12 and this can be in part related to exposure to antibiotics 13.

P. aeruginosa is a facultative aerobe that preferentially uses oxygen as final electron acceptor during aerobic respiration but can also grow and multiply in anaerobiosis if there are enough nitrite or nitrate concentrations to obtain energy from denitrification. Four reductases are involved in this process, one of which is NirS. Arginine deamination is an alternative way but is less effective than denitrification 14-17.
Hypoxemic conditions in CF lungs were demonstrated by direct measuring of oxygen in the mucosal surface 14 and by the identification of strict anaerobic bacteria 14,18. P. aeruginosa adapt to these conditions by preferentially using anaerobic respiration 19.
The action of aminoglycosides, an important class of antibiotics used to treat acute exacerbations, is compromised within biofilms because their transport through the cytoplasmatic membrane is oxygen-dependant 20. P. aeruginosa can also acquire resistance to aminoglycosides by two main mechanisms: active elimination of the molecule by efflux pumps and enzymatic hydrolysis 21. Overexpression of the inducible efflux pump MexXY-OprM is considered the most frequent mechanisms of acquired aminoglycoside resistance in CF patients 22 and is due to mutations in different genes involved in the regulation of expression, notably mexZ repressor, fusA1 that encodes for an elongation factor G and amgRS that encodes for a two-component regulatory system 23.
We aimed to investigate the growth conditions of P. aeruginosa and the expression of some determinants of resistance by measuring genetic expression directly into the sputa (in vivo) and in strains isolated from these sputa (in vitro) in patients with CF.

METHODS
Patients and strains
A convenience sample of 26 patients who attended the Department of Respiratory Diseases of the University Hospital Centre (CHU) at Besançon (France) and who agreed to participate was studied. Sequential sputa were collected between February 2006 and June 2007 under respiratory physiotherapy both during chronic colonisation and during acute exacerbations. Part of each sputum sample was used for semi-quantitative culture, isolation of P. aeruginosa strains and antibiotic susceptibility at the Bacteriology Laboratory at CHU. The remaining sample was frozen at -80ºC immediately after collected and was used for genetic analysis at the Department of Microbiology and Molecular Medicine of the University Medical Centre (CMU) of Geneva School of Medicine.
The study was accepted by the Research Ethics Committee and all patients signed informed consent to participate.

Genotyping
To compare genotypes between strains isolated from each patient, random amplification of polymorphic DNA (RAPD) with primer 207 24 was used. PCR conditions were as follows: 94°C for 5 minutes; 45 cycles at 94 °C for 1 minute; 36°C for 1 minute; 72°C for 2 minutes and final extension at 72°C for 10 minutes. PCR products underwent electrophoresis on 1.5% Tris-Borate-EDTA (TBE) agarose gel and the banding patterns were visually analysed. Two strains were considered to belong to the same genotype if its RAPD profile was not different in more than 2 bands.

DNA and RNA extraction from sputa
Two samples per each sputum were extracted and analysed in parallel. The sputum was solubilised in 4 ml of Trizol per gram of sputum. Dithiothreitol (DTT) was added to obtain a final concentration of 100 µg/ml (0.64 mM). After homogenization, 2 aliquots of 5 ml were transferred into 2 Falcon tubes of 14 ml. The extraction was performed with 1 ml of chloroform. Samples were centrifuged at 10,000 rpm for 15 minutes at 4°C. The upper phase was removed for RNA extraction; the inter- and lower- phases were kept at 4°C for DNA extraction. Four ml of isopropanol were added to the upper phase, then mixed and incubated for 10 minutes and finally centrifuged at 4000 rpm for 45 minutes. The supernatant was removed and the RNA pellet was suspended in 1 ml of 75% ethanol. After centrifugation, the supernatant was removed and the RNA pellet was dried for 10 minutes. RNA was suspended in 75 µl of RNAse-free water, incubated at 65°C for 10 minutes, then treated with DNase (Promega RQ1 DNAseTM) for 50 minutes. Samples were purified using RNeasy columns (QiagenTM) and RNA was eluted with 30 µl of RNase-free water. RNA concentration was measured at 260 nm and then stored at -80°C.

DNA was extracted from the interphase by adding back extraction buffer and then mixing for 3 minutes. The tubes were then centrifuged at 10,000 rpm for 15 minutes at 4°C. Isopropanol (0.6 ml) was added to the supernatant and mixed for 5 minutes at room temperature. After centrifugation at 10,000 rpm at 4°C for 15 minutes, the pellet containing the DNA was recovered and suspended in 1 ml of 75% ethanol, then centrifuged again. The DNA pellet was dried, suspended in 10 mM Tris buffer pH 8.0 and stored at -20°C.

RNA extraction from bacterial strains
Strains were grown in Luria-Bertani broth (LB) to reach mid-exponential growth phase (DO600 between 1.5-2.0). Aliquots of approximately 1x109 bacteria were treated with 2 volumes of RNA stabiliser (RNAprotect bacteria, QiagenTM). Strains were also grown in solid media (LB + 2% agar -LBA) in aerobiosis (37ºC and room atmosphere during 18-22 hs) and in anaerobiosis (LBA supplemented with 50mM of KNO3 at 37ºC and atmosphere generated with GeneBagTM (Biomérieux) to obtain less than 0.1% of oxygen) at the same time. After incubation, bacterial suspensions corresponding to 5x108 colony forming units were prepared in sterile water by measuring the DO600. These suspensions were mixed with 2 volumes of RNAprotect bacteria reagent (QiagenTM) and supplier’s instructions were followed. Each strain was studied in duplicate both in aerobiosis and anaerobiosis. Bacterial pellets were suspended in 100 µl of lysozyme (3 mg/ml) and RNA was extracted according to the supplier’s protocol. Extracted RNA was eluted in 45 µl of RNAse-free water and treated immediately with DNAse RQ1 (PromegaTM) in the presence of 2 µl of RNAsin (PromegaTM). The reaction was incubated at 37ºC for 60 minutes. RNA concentration was measured at 260 nm and frozen at -80ºC.

Reverse transcription
One µg of RNA was used for reverse transcription in a mix containing 8 µl of 2.5 mM dNTPs, 0.5 µl of random hexanucleotides at 500 µg/ml and RNAse- free water (total volume 24 µl). The reaction was incubated at 65ºC for 5 minutes and then chilled on ice. Eight µl of first strand buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2 and 50 mM DTT), 4 µl of MgCl2 and 2 µl of RNAsin (PromegaTM) were added and incubated during 10 minutes at room temperature, then 2 minutes at 42ºC. Half of the sample (19 µl) was transferred to a new tube and 1 µl of reverse transcriptase ImProm-II (PromegaTM) was added. The remaining sample was used as control. Complementary DNA (cDNA) synthesis was carried out at 42ºC for 50 minutes. The enzyme was then inactivated at 70ºC for 15 minutes and the samples were diluted in 45 µl of RNAse-free water.

In vivo and in vitro gene expression
The following genes were selected for study over sputum samples and strains: nirS (coding for a nitrite reductase necessary for anaerobic growth using denitrification); mexY (inner membrane antiporter component of the MexXY-OprM efflux pump); and mexZ (mexY repressor). The selection was made on the basis of previous experiments on 70 sputa and 39 strains from 20 patients where the following genes involved in denitrification were tested: nirS, norB and narG. We found that nirS and norB were always induced in anaerobiosis, but nirS gave higher values. On the other hand, narG was not always induced (data not shown). The MexXY- OprM efflux pump was chosen because its over- expression is the most common mechanism of aminoglycoside resistance in CF isolates 23 and it can also contribute to ß-lactam and fluroquinolone resistance, three main antibiotics in the treatment of CF patients, although these resistances may be isolated from patients without CF 25,26.

Real time PCR (Rotor-Gene 3000 – CorbettTM, Australia) was used to quantify cDNA with 3 µl of cDNA as template and the following reaction components: 7.5 µl of QuantiTect SYBR GreenTM (Qiagen), 0.9 µl of each template and 2.7 µl of water.
The housekeeping gene rpsL was always amplified along with the three genes under investigation to normalise the results; expression levels were calculated as number of copies per gram of sputum and normalised by the number of copies of rpsL. Primers’ sequences (5’-3’)

rpsL-F: GCAAGCGCATGGTCGACAAGA;
rpsL-R, CGCTGTGCTCTTGCAGGTTGTGA;
mexY1, TGGTCAACGTCAGCGCCAGCTAT;
mexY2, TCGACGATCTTCAGGCGGTTCTG;
mexZ-F1, CGGCGCGACAGTAGCATATAAT;
mexZ-R1, TCGAAATCGATTCGGAACAAG;
nirS-1: CCATCCGAAGTCCTCGCACCTCT;
nirS-2: TTCATCGCCGCGCTTGTTGTACT;

Two samples per sputum were extracted and analysed in parallel; the mean value was then used. In vitro nirS induction was calculated as the ratio anaerobic expression / aerobic expression (nirS/rspL in anaerobiosis / nirS/rspL in aerobiosis). Growth conditions were classified as aerobic or anaerobic by comparing expression rates in vivo and in vitro (in aerobiosis and anaerobiosis) for each patient. Due to the variability observed in nirS induction between different strains from the same patient, we used the mean ratio of expression of all the strains isolated from a same sputum sample. nirS induction rates were compared to those of the reference strain PAO1 (www.pseudomonas.com). To establish if variations of mexY expression were caused by mutations in mexZ, a region 1Kbp of genomic DNA (gDNA) extracted from sputa that includes this gene was amplified. The sequences of the obtained amplicons were compared to the sequence of mexZ from strain PAO1.

Antibiotic resistance
Antibiotic resistance was determined at CHU Besançon by Kirby-Bauer disk diffusion method to the following classes: aminoglycosides (gentamycin, amikacin, tobramycin), fluroquinolones (ciprofloxacin) and beta-lactams (tazobactam-piperacillin, ceftazidime, imipenem, meropenem). Results were interpreted according to The European Committee on Antimicrobial Susceptibility Testing (EUCAST) 2023 27, except for gentamycin for which no breakpoints are available from 2020 for this committee, so it was interpreted according to EUCAST 2019 28. Antibiotic profiles were correlated with the level of expression of mexY and mutations in mexZ. Strains were classified as multi-resistant when they presented resistance to 3 or more classes of antibiotics 29. For the purposes of this paper and to simplify the interpretation, we denominate strains with no resistance to the 3 tested classes as “fully susceptible although they can present resistance to no tested antibiotics.

Statistical analysis
One-tway ANOVA test with a significance level of 0.5 was used to compare mean mexY/rpsL values between susceptible/susceptible, increased exposure, resistant to only one antibiotic class and multi-resistant strains, and to compare differences in the expression of in vivo mexY expression between wild type and mexZ mutant strains.

RESULTS
Bacterial load in sputa and genotyping of strains One hundred twelve sputa were obtained from 26 patients. Fourteen were excluded because one or more of the following reasons: intermittent or no colonisation with P. aeruginosa; less than 2 sputa per patient; absence of strain/s isolated from the sputa. Twelve patients were retained for further study. Eleven samples from 3 patients had low bacterial load (less than 2x106  rpsL copies/gram and less than 105 CFU/ml of sputum in cultures) and were excluded from the study. The final study population consisted in the remaining 9 patients (identified with letters from A to I) from whom 56 sputa were included because they contained more than 106  copies/gram of rpsL and more than 106 CFU/ml of sputum. Bacterial load determined by qRT-PCR of gDNA from sputa correlated with semi- quantitative cultures.
Analysis by RAPD demonstrated that 7 patients carried a single genotype while the other 2 carried two different genotypes each one (data not shown). The sample collection time period for each patient was as follows: C 17 months; A, F, G and H 16 months; E 14 months; I 9 months; D 8 months; B 7 months.

Antibiotic resistance and expression of MexXY efflux pump
Resistance percentages to the tested antibiotics were as follows: gentamycin 46, amikacin 38, tobramycin 51, ciprofloxacin 61, tazobactam-
piperacillin 56, ceftazidime 56, imipenem 61 and meropenem 39. Nine strains from 3 patients were susceptible to all tested antibiotics while 4 strains from 3 patients were resistant to all. These two were the most frequent resistance profiles, followed by other multi-resistant profiles. In total, 33 different profiles were found. Most of them included resistance to ß-lactams (28/33) and to aminoglycosides (24/33), while ciprofloxacin was present in 20/33. Profiles are shown in table 1 along with distribution by patient. Regarding resistance to aminoglycosides: 11 strains were resistant to 1, 10 were resistant to 2 and 10 were resistant to the 3 tested antibiotics of this class. No statistical differences were found between resistant vs. susceptible/susceptible, increased exposure strains for any antibiotic.

Table 1. Distribution of resistance profiles by patient

AN: amikacin; CAZ: ceftazidime; CIP: ciprofloxacin; GN: gentamycin; IPM: imipenem; MER: meropenem; TM:tobramycin; TZP: tazobactam-piperacillin. In bold: profile resistant to all tested antibiotics.

Table 2. Distribution of number of strains according to the number of classes of antibiotics to which the strains are resistance and mean mexY/rpsL expression.

*Fold-change from PAO1

Expression of mexY was detectable in all the 53 analysed sputa at more than 5 x 104 copies/gram. The expression ratios of mexY/rpsL ranged from
0.02 (patient A) to 0.4 (patients D and H). No statistically significant differences were found in mean expressions of mexY in vivo (p = 0.57) or in vitro (p = 0.13) between fully susceptible, resistant to less than 3 antibiotic classes and multi-resistant strains. In fact, the lowest mean expression level was observed for multi-resistant strains (Table 2). Statistical differences were neither found between in vivo (p = 0.70) or in vitro mexY expression (p = 0.13) among strains resistant to 1, 2 or the 3 tested aminoglycosides.
We found that all the patients were colonised with strains carrying mutations in mexZ. Wild type mexZ allele was only found in the first 3 sputum samples obtained from patient A; these sputa expressed the lowest levels of mexY. On this basis, we have established an arbitrary threshold to classify sputum samples containing wild type and mutated mexZ; it corresponded to the mean expression of mexY/rpsL of these 3 sputa, being the value of
0.06 (Figure 1).

Figure 1. Expression level of mexY in vivo and corresponding status of mexZ.

Black line : threshold to differentiate mezZ wild type from mutants (0,06)

Expression of mexY in vitro could be determined for 33 strains. Results for each patient ranged from: 8 to 19 (patient A); 12 to 25 (patient B); 3 to 30 (patient C); 14 (both strains from patient D); 24 (one strain from patient E); 25 to 33 (patient F); 26 to 81 (patient G); 11 to 42 (patient H); 9 to 21 (patient I). Expression levels of mexY in vivo were compared to that in vitro by dividing mexY/rpsL ratio from each sputum sample by the mean ratio of mexY/rpsL of all strains corresponding to each patient. Figure 2 shows in vivo / in vitro ratios according to mexZ allele status. It demonstrates that in vivo mexY expression in sputa containing mexZ mutated populations was 1 to 5 times higher than the expression of the 3 sputa from patient A (p = 0.0035). Among 43 sequenced strains, mean mexY in vitro expression ranged from 0.043 (wild type) to 0.231 (∆ mutation) but, again, no statistically significant differences were found in the expression level when comparing strains carrying each mutation.

Regarding correlation between mexZ mutations and antibiotic resistance profile, we found that the 3 wild type strains were resistant to 2 or 3 antibiotic classes; the 3 strains with the double mutation G137D + L138R were susceptible to all tested antibiotics; and the 3 strains with ∆1bp were only resistant to ciprofloxacin +/- amikacin. No other correlations were evident between type of mexZ mutation and resistance profile.

Figure 2. Expression level of mexY (in vivo / in vitro ratio) in sputum samples containing wild type and mutated mexZ.

Expression of nirS in vitro and in vivo
All strains except 3 grew in anaerobiosis. These strains corresponded to 3 different patients and all of them exhibited a small colony phenotype. As expected, the expression level of nirS was higher in anaerobiosis than in aerobiosis, meaning that its expression was induced under anaerobic conditions. Nevertheless, induction rates were highly variable, with a range between 2 and 1494. Moreover, 2 All strains except 3 grew in anaerobiosis. These strains corresponded to 3 different patients and all of them exhibited a small colony phenotype. As expected, the expression level of nirS was higher in anaerobiosis than in aerobiosis, meaning that its expression was induced under anaerobic conditions. Nevertheless, induction rates were highly variable, strains isolated from the same sputum could have very different induction rates, sometimes close to a 20-fold (ex.: strains 5a and 5b from patient G) (Table 3). The median induction rate was 38, which is slightly higher than the value measured for PAO1 reference strain (between 20 and 30).

Table 3. Induction of nirS

By measuring cDNA levels for the gene nirS directly into sputum samples and after normalisation with rpsL, we determined nirS expression in vivo. These values were compared with those obtained in vitro for each patient (Figure 3).

Figure 3. In vivo and in vitro comparison of nirS expression levels

*Samples collected during acute exacerbations.
*Samples collected during acute exacerbations.
Mean levels (red and grey lines) and the range (boxes) of in vitro expression in aerobiosis and anaerobiosis with respect to the expression levels in vivo (Y axis). Grey zones represent nirS/rpsL rates measured in aerobiosis (20% of oxygen) while red zones represent ratios measured in anaerobiosis (<0.1% of oxygen). Zones localized between grey and red boxes define a microaerophilic zone.

Anaerobic in vitro expression is comparable between the 9 patients (rates 1.3 to 3.6); in contrast, aerobic in vitro expression shows great variability (0.04 to 0.18). These results are due to a very high aerobic nirS expression level for few strains from patients B, E, H and I. According to clinical information, no relationship exists between nirS expression during acute exacerbations (asterisks in Figure 3) compared to chronic disease.

Discussion and conclusions
The objective of this study was to further understand the behaviour and the growth conditions of P. aeruginosa when colonising the complex environment of the lungs of patients with CF. We adapted a previous published method 30 for the in vivo analysis of genetic expression in tracheal aspirates from intubated patients and applied it to analyse sputum samples of 9 CF patients. In this way we measured the expression of the mexY gene, coding for the protein MexY (the inner membrane antiporter of the three-component MexXY-OprM efflux pump 22) and a gene involved in anaerobic growth by denitrification (nirS nitrite-reductase).

Two out of the nine patients (22%) carried a single genotype identified by RAPD. This finding is in agreement with previous analysis of P. aeruginosa from chronic stage of CF patients showing that in a period of up to 20 months cloning-derived mutants exhibited up to 20% divergence in genomic macrorestriction patterns 31. Nevertheless, it has been demonstrated that mutator strains are present in less than 10% of P. aeruginosa strains in early stages of CF but this figure reaches up to 60% in chronic infection 32. In fact, it is known that over longer periods of time (up to 25 years) hypermutation leading to a loss of virulence, adaptation to biofilms and acquisition of higher antibiotic resistance levels, among others, is necessary to establish chronic infection 12,33.
Even though our study period was relatively short we observed high rates of antibiotic resistance, being the lowest for amikacin (38%), and 41% of strains exhibited multi-resistance. As we do not have enough clinical data, these findings may indicate that most patients were already at a chronic stage of the disease.

It is worth to point out that susceptibility testing guidelines, such as EUCAST, have undergone deep changes over the last years. For P. aeruginosa these changes included the elimination of breakpoints for gentamycin because of its low efficacy and more recently the recommendation to use amikacin only for urinary tract infections. Tobramycin remains as the only aminoglycoside for use in infections originating in other body sites. However, the mechanism that we investigated is the most frequent for intrinsic and acquired aminoglycoside resistance in CF patients and we were able to demonstrate that its overexpression is directly linked to the presence of mexZ mutant populations.
All strains from patient D were fully susceptible and, for a global in vitro mexY expression level of 3 to 81-fold-change in reference to PAO1, the in vitro level for this patient was low (14-fold-change); nevertheless in vivo mexY expression were among the highest. On the opposite, all strains from patient G were multi-resistant while in vitro mexY expression was the highest (26 to 81-fold-change) but in vivo mexY expression were from average to low. It seems clear that other in vivo factors that we did not account for play an important role in gene expression.

We found that only 1 out of the 9 studied patients was colonised by wild type mexZ repressor gene. Among the remaining 8 patients, all the identified mutations in mexZ were predicted as non-tolerated by the SIFT algorithm (https://sift.bii.a-star.edu.sg), indicating a complete loss of the function of this protein. These mutant populations were probably selected during aminoglycoside treatment. Of note, all the involved patients received amikacin or tobramycin at a certain point during the study period. The regulator mexZ was previously reported as the most frequently mutated gene among 29 CF patients 33,34. The fact that no statistically significant differences were observed in mexY expression between strains fully susceptible or resistant to one, two or three antibiotic classes, could indicate that other factors influence the expression of antibiotic resistance and/or of MexXY-OprM. Actually, it has recently been demonstrated that mutations in genes other than mexZ (fusA1 and amgRS) have a higher impact on reducing aminoglycoside susceptibility and that combination of mutations in the three genes have a stronger effect 23.

For three patients the type of mexZ mutation correlated with the resistance profile, although the association was inverse to what was expected: strains harbouring wild type mexZ were resistant to 2 classes (not including aminoglycosides) or multi- resistant (including aminoglycosides) while double mutants were fully susceptible. It is expected that the resistant strains express other mechanisms.
In comparison with in vitro measurements, mexY expression was 2 to 5 times higher than the expression in sputum samples containing mutant populations. This also suggests that in the absence of repression mediated by mexZ it could be an additional increase in the expression of mexY when bacteria develop in vivo.

The gene mexY was not induced in anaerobiosis (data not shown). This finding indicates that environmental factors other than the atmosphere have an incidence in the increased expression of this gene. One of such factors could be the presence of reactive oxygen species (ROS) generated during the chronic inflammation phase of CF. In fact, it was previously suggested that oxidation of bacterial DNA by ROS is responsible for an increased risk of hypermutation 32 and that hydrogen peroxide is able to induce mexY in vitro and to increase the frequency of strains resistant to aminoglycosides 35. Using the same set of samples, we measured the in vivo and in vitro nirS expression to estimate growth conditions of P. aeruginosa in the lungs of these patients. All the 56 studied strains demonstrated nirS induction under anaerobic conditions, although expression levels were highly variable. PAO1 induction rates were similar to what is described by elsewhere (ratio 20-30) 15. Induction of nirS is regulated in anaerobiosis by the transcriptional activator Dnr which is, in turn, under control of the regulator of nitrate reduction in anaerobiosis Anr 36,37 and of the NarL/NarX nitrate detection system36. nirS operon is directly or indirectly repressed by the quorum-sensing regulator RhlR 38. Anr and Dnr are necessary for anaerobic but not for microaerophilic growth 15. We assume that both Anr and Dnr regulators were functional in all the strains that were able to grow in anaerobiosis (all but three). The differences in induction rates could be the result of a peripheric regulation via de quorum-sensing system or of nirS expression under microaerophilic conditions39.

If we extrapolate in vitro values to sputum samples we can establish the following classification: 32 out of 54 (59%) sputa give values compatible with aerobic conditions, 6/54 (11%) give values in the lower limit of anaerobic zone and the remaining 16 (30%) show microaerophilic conditions. Sputa from patients B and I are all classified as aerobic while most samples from patient A show levels closer to anaerobiosis. Samples from patient G exhibit a temporal tendence towards anaerobiosis but no such tendence is observed for the other patients. In accordance with our findings, a previous article of in vitro experiments mimicking CF lungs conditions shows that P. aeruginosa grows preferentially under aerobic or microaerobic atmosphere 15. In vivo data obtained in the present study is in favour of an heterogeneous environment where different bacterial sub-populations develop using aerobic respiration (with oxygen as final electron acceptor) in the mucous surface and under microaerophilic/anaerobic conditions deeper within the mucus, as it was previously published 14,15. Bacteria developing within zones of aerobic conditions are probably planktonic, as opposed to those developing in zones of low oxygen concentration, situation that promotes biofilm production.

We analysed more than 50 sputa allowing us to compare in vivo expression for a same patient and to follow its evolution. Our study period was 17 months so, even if it is not a neglectable follow-up time, it limited our possibility to observe trends in the behaviour of P. aeruginosa during chronic infections. Nevertheless, we were able to obtain some useful conclusions.

The present study allowed us to predict different aminoglycoside efficacy according to mexY in vivo expression and growth conditions. For instance, patient A exhibited the lowest mexY in vivo expression levels. Nevertheless, most of the strains isolated from their sputa indicates growth under microaerophilic/anaerobic  atmosphere,  conditions under which aminoglycosides do not have activity. In contrast, all sputum samples from patient F indicate aerobic conditions but mexY expression was among the highest. According to these two parameters and to the persistence of mexZ mutated populations over a 17-month period, it is reasonable to predict that aminoglycoside treatment will only allow to eradicate a small proportion of P. aeruginosa population. Inhaled tobramycin, the only recommended aminoglycoside for respiratory infections 27,40, reaches intraluminal concentration well over the minimal inhibitory concentration for P. aeruginosa 41. In consequence, mutant mexZ population could be eradicated during tobramycin inhaled treatment under aerobic conditions. Sputum samples analysed in the present study were obtained under respiratory physiotherapy and should come from the lower respiratory tract. However, we cannot exclude the possibility that sputum quality was no homogeneous, i.e., there could be samples coming from upper respiratory tract with exposition to higher oxygen concentrations.

Antibiotics such as aminoglycosides, quinolones and ß-lactams could eliminate planktonic bacteria which account for the biggest bacterial mass accumulated during acute exacerbations, but they would not have any effect on bacteria growing within biofilms. This is the concerning group of bacteria that acts as a reservoir during chronic infections.
Although expression levels were variable and did not indicate a particular trend, we were able to establish a threshold to differentiate basal levels of mexY expression, corresponding to wild type mexZ gene, and overexpression corresponding to a mutated population. Our results show that heterogeneous populations (wild type and mutated) of P. aeruginosa colonise CF lungs. In our study population, mexZ mutated populations were by far the most frequent (3/54 sputa and 1/9 patients). Even though we do not have complete clinical data we know that all patients were under aminoglycoside prophylaxis or treatment at some point during the study period. It would be interesting to investigate if variations in the genetic expression in a single patient is a result of relative proportions of wild type and mutated populations or if they are rather due to a modulation of mexY expression within a single homogeneous population. The occurrence of different mexZ mutations, even among strains from a same patient, suggests a repeated selection and might be independent from mutant mexZ alleles.

We did not find a correlation between mexY expression and aminoglycoside’s susceptibility profile. This observation was already made twenty years ago but in that case no mutations in mexZ regulator were found 26, although the authors conclude that MexXY overexpression in aminoglycoside resistant strains occurs via mutation in one or more genes that were not identified at the time of the study. We now know that mutations in fusA1 and amgRS have a greater impact than mexZ in reducing aminoglycoside susceptibility 23.
Few studies have so far analysed gene expression of P. aeruginosa in vivo in patients with CF, either by measuring gene expression directly into clinical samples 42-44 or under laboratory conditions mimicking human conditions or animal models 45,46. It is worth noting that molecular analysis for the present study was performed more than ten years ago. Great advances had been made in the field of genomics since then, with transcriptomics and proteomics widely used now-a-days. Yet, new treatment strategies focusing on the complex environment of CF lungs are lacking.

Conclusions
Measures of in vivo and in vitro gene expression showed that sputum samples harbouring wild type mexZ alleles expressed the lowest levels of mexY, allowing us to establish cut-off of to differentiate sputum samples carrying mutant from wild type mexZ. We also estimated that the isolated strains grew preferentially under aerobic or microaerophilic conditions in the lungs. As well as other few studies investigating in vivo gene expression of P. aeruginosa, our results shed some light about the behaviour of this bacterium when colonising patients with CF. However, they cannot entirely explain all factors influencing the persistent infection and the progression of antibiotic resistance, making it difficult to design new therapeutic approaches.

Conflict of interests
None

Funding statement
This work was supported by the Foundation Vaincre la Mucoviscidose, Paris-France. MMV received a fellow grant from the Swiss Society of Infectious Diseases.

Acknowledgments
Part of this study was carried out as the author’s thesis for the obtention of a Master in Advanced Studies in Clinical Medicine at the University of Geneva. The author is very grateful to Professors Christian Van Delden and Daniel Lew for accepting to direct the thesis, and to Thilo Khöler, senior researcher who guided me all over the investigation. Thank you very much Cyril Amstutz, who started this project, and Benedicte Richaud- Thiriez, Jean-Charles Dalphin and Patrick Plésiat from the Centre Universitaire Besançon, where patients were enrolled and microbiological studies were performed. Finally, a great recognition to the patients who agreed to collaborate with clinical investigation.

References
1. De Boeck K. Cystic fibrosis in the year 2020: A disease with a new face. Acta Paediatr. May 2020;109(5):893-899. doi:10.1111/apa.15155
2. Sagel SD, Gibson RL, Emerson J, et al. Impact of Pseudomonas and Staphylococcus infection on inflammation and clinical status in young children with cystic fibrosis. J Pediatr. Feb 2009;154(2):183-8. doi:10.1016/j.jpeds.2008.08.001
3. Almughem FA, Aldossary AM, Tawfik EA, et al. Cystic Fibrosis: Overview of the Current Development Trends and Innovative Therapeutic Strategies. Pharmaceutics. Jul 2 2020;12(7)doi:10.3390/pharmaceutics12070 616
4. Chernish RN, Aaron SD. Approach to resistant gram-negative bacterial pulmonary infections in patients with cystic fibrosis. Curr Opin Pulm Med. Nov 2003;9(6):509-15. doi:10.1097/00063198-200311000-00011
5. Razvi S, Quittell L, Sewall A, Quinton H, Marshall B, Saiman L. Respiratory microbiology of patients with cystic fibrosis in the United States, 1995 to 2005. Chest. Dec 2009;136(6):1554-1560. doi:10.1378/chest.09-0132.
6. Bhagirath AY, Li Y, Somayajula D, Dadashi M, Badr S, Duan K. Cystic fibrosis lung environment and Pseudomonas aeruginosa infection. BMC Pulm Med. Dec 5 2016;16(1):174. doi:10.1186/s12890-016-0339-5
7. Camus L, Vandenesch F, Moreau K. From genotype to phenotype: adaptations of Pseudomonas aeruginosa to the cystic fibrosis environment. Microb Genom. Mar 2021;7(3)doi:10.1099/mgen.0.000513
8. Sauer K, Rickard AH, Davies DG. Biofilms and biocomplexity. Microbe-American Society for Microbiology. 2007;2(7):347.
9. Lee K, Yoon SS. Pseudomonas aeruginosa Biofilm, a Programmed Bacterial Life for Fitness.    J    Microbiol    Biotechnol.    Jun    28 2017;27(6):1053-1064. doi:10.4014/jmb.1611.11056
10. Hassett DJ, Sutton MD, Schurr MJ, Herr AB, Caldwell    CC,    Matu    JO.    Pseudomonas aeruginosa hypoxic or anaerobic biofilm infections within cystic fibrosis airways. Trends Microbiol. Mar 2009;17(3):130-8. doi:10.1016/j.tim.2008.12.003
11. Ciofu O, Tolker-Nielsen T. Tolerance and Resistance of Pseudomonas aeruginosa Biofilms to Antimicrobial Agents-How P. aeruginosa Can Escape Antibiotics. Front Microbiol. 2019;10:913. doi:10.3389/fmicb.2019.00913
12. Winstanley C, O\'Brien S, Brockhurst MA. Pseudomonas    aeruginosa    Evolutionary Adaptation and Diversification in Cystic Fibrosis Chronic Lung Infections. Trends Microbiol. May 2016;24(5):327-337. doi:10.1016/j.tim.2016.01.008
13. Khan F, Lee JW, Javaid A, Park SK, Kim YM. Inhibition of biofilm and virulence properties of Pseudomonas aeruginosa by sub-inhibitory concentrations of aminoglycosides. Microb Pathog. Sep 2020;146:104249. doi:10.1016/j.micpath.2020.104249
14. Worlitzsch D, Tarran R, Ulrich M, et al. Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients. J Clin Invest. Feb 2002;109(3):317- 25. doi:10.1172/JCI13870
15. Alvarez-Ortega C, Harwood CS. Responses of Pseudomonas aeruginosa to low oxygen indicate that growth in the cystic fibrosis lung is by aerobic respiration. Mol Microbiol. Jul 2007;65(1):153-65. doi:10.1111/j.1365- 2958.2007.05772.x
16. Linnane SJ, Keatings VM, Costello CM, et al. Total sputum nitrate plus nitrite is raised during acute pulmonary infection in cystic fibrosis. Am J Respir Crit Care Med. Jul 1998;158(1):207- 12. doi:10.1164/ajrccm.158.1.9707096
17. Palmer KL, Brown SA, Whiteley M. Membrane- bound    nitrate    reductase is    required for anaerobic growth in cystic fibrosis sputum. J Bacteriol. Jun 2007;189(12):4449-55. doi:10.1128/JB.00162-07
18. Tunney MM, Field TR, Moriarty TF, et al. Detection of anaerobic bacteria in high numbers in sputum from patients with cystic fibrosis. Am J Respir Crit Care Med. May 1 2008;177(9):995-1001. doi:10.1164/rccm.200708-1151OC
19. Yoon SS, Hennigan RF, Hilliard GM, et al. Pseudomonas aeruginosa anaerobic respiration in biofilms: relationships to cystic fibrosis pathogenesis. Dev Cell. Oct 2002;3(4):593- 603. doi:10.1016/s1534-5807(02)00295-2
20. MacDougall C, Schooley RT. Miscellaneous Antibacterials: Aminoglycosides, Polymyxins, Urinary Antiseptics, Bacteriophages. In: Brunton LL, Knollmann BC, eds. Goodman &amp; Gilman\'s: The Pharmacological Basis of Therapeutics, 14e. McGraw-Hill Education; 2023.
21. Livermore DM. Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: our worst nightmare? Clin Infect Dis. Mar 1 2002;34(5):634-40. doi:10.1086/338782
22. Morita Y, Tomida J, Kawamura Y. MexXY multidrug    efflux    system    of    Pseudomonas aeruginosa. Front Microbiol. 2012;3:408. doi:10.3389/fmicb.2012.00408
23. Thacharodi A, Lamont IL. Gene-Gene Interactions Reduce Aminoglycoside Susceptibility of Pseudomonas aeruginosa through Efflux Pump-Dependent and - Independent Mechanisms. Antibiotics (Basel). Jan 11 2023;12(1)doi:10.3390/antibiotics12010152
24. Mahenthiralingam E, Campbell ME, Foster J, Lam    JS,    Speert    DP.    Random    amplified polymorphic DNA typing of Pseudomonas aeruginosa isolates recovered from patients with cystic fibrosis. J Clin Microbiol. May 1996;34(5):1129-35. doi:10.1128/jcm.34.5.1129-1135.1996
25. Vogne C, Aires JR, Bailly C, Hocquet D, Plesiat P. Role of the multidrug efflux system MexXY in the emergence of moderate resistance to aminoglycosides    among    Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Antimicrobial agents and chemotherapy. May 2004;48(5):1676-80. doi:10.1128/AAC.48.5.1676-1680.2004
26. Sobel ML, McKay GA, Poole K. Contribution of the MexXY multidrug transporter to aminoglycoside resistance in Pseudomonas aeruginosa clinical isolates. Antimicrobial agents and chemotherapy. Oct 2003;47(10):3202-7. doi:10.1128/AAC.47.10.3202-3207.2003
27. The European Committee on Antimicrobial Susceptibility Testing - EUCAST. Breakpoint tables for interpretation of MICs and zone diameters. 2023. http://www.eucast.org
28. The European Committee on Antimicrobial Susceptibility Testing - EUCAST. Breakpoint tables for interpretation of MICs and zone diameters. Version 9.0 ed2019.
29. Magiorakos AP, Srinivasan A, Carey RB, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. Mar 2012;18(3):268-81. doi:10.1111/j.1469-0691.2011.03570.x
30. Kohler T, Guanella R, Carlet J, van Delden C. Quorum sensing-dependent virulence during Pseudomonas    aeruginosa    colonisation    and pneumonia in mechanically ventilated patients. Thorax. Aug 2010;65(8):703-10. doi:10.1136/thx.2009.133082
31. Struelens MJ, Schwam V, Deplano A, Baran D. Genome macrorestriction analysis of diversity and variability of Pseudomonas aeruginosa strains infecting cystic fibrosis patients. J Clin Microbiol. Sep 1993;31(9):2320-6. doi:10.1128/jcm.31.9.2320-2326.1993
32. Ciofu O, Riis B, Pressler T, Poulsen HE, Hoiby N. Occurrence of hypermutable Pseudomonas aeruginosa in cystic fibrosis patients is associated with the oxidative stress caused by chronic lung inflammation. Antimicrobial agents and chemotherapy. Jun 2005;49(6):2276-82. doi:10.1128/AAC.49.6.2276-2282.2005
33. Smith EE, Buckley DG, Wu Z, et al. Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc Natl Acad Sci U S A. May 30 2006;103(22):8487- 92. doi:10.1073/pnas.0602138103
34. Mena A, Smith EE, Burns JL, et al. Genetic adaptation of Pseudomonas aeruginosa to the airways of cystic fibrosis patients is catalyzed by hypermutation. J Bacteriol. Dec 2008;190(24):7910-7. doi:10.1128/JB.01147-08
35. Fraud S, Poole K. Oxidative stress induction of the MexXY multidrug efflux genes and promotion of aminoglycoside resistance development in Pseudomonas aeruginosa. Antimicrobial agents and chemotherapy. Mar 2011;55(3):1068-74. doi:10.1128/AAC.01495-10
36. Benkert B, Quack N, Schreiber K, Jaensch L, Jahn D, Schobert M. Nitrate-responsive NarX- NarL represses arginine-mediated induction of the Pseudomonas aeruginosa arginine fermentation arcDABC operon. Microbiology (Reading). Oct 2008;154(Pt 10):3053-3060. doi:10.1099/mic.0.2008/018929-0
37. Trunk K, Benkert B, Quack N, et al. Anaerobic adaptation in Pseudomonas aeruginosa: definition of the Anr and Dnr regulons. Environ Microbiol. Jun 2010;12(6):1719-33. doi:10.1111/j.1462-2920.2010.02252.x
38. Toyofuku M, Nomura N, Fujii T, et al. Quorum sensing    regulates    denitrification    in Pseudomonas aeruginosa PAO1. J Bacteriol. Jul 2007;189(13):4969-72. doi:10.1128/JB.00289-07
39. Chen F, Xia Q, Ju LK. Competition between oxygen and nitrate respirations in continuous culture of Pseudomonas aeruginosa performing aerobic denitrification. Biotechnol Bioeng. Apr 20 2006;93(6):1069-78. doi:10.1002/bit.20812
40. Clinical and Laboratory Standards Institute. M100 ED33:2023 - Performance Standards for Antimicrobial Susceptibility Testing. 33rd ed2023.
41. Geller DE, Pitlick WH, Nardella PA, Tracewell WG, Ramsey BW. Pharmacokinetics and bioavailability of aerosolized tobramycin in cystic fibrosis. Chest. Jul 2002;122(1):219-26. doi:10.1378/chest.122.1.219
42. Cornforth DM, Dees JL, Ibberson CB, et al. Pseudomonas aeruginosa transcriptome during human infection. Proc Natl Acad Sci U S A. May 29 2018;115(22):E5125-E5134. doi:10.1073/pnas.1717525115
43. Gifford AH, Willger SD, Dolben EL, et al. Use of a Multiplex Transcript Method for Analysis of Pseudomonas aeruginosa Gene Expression Profiles in the Cystic Fibrosis Lung. Infect Immun. Oct 2016;84(10):2995-3006. doi:10.1128/IAI.00437-16
44. Rossi E, Falcone M, Molin S, Johansen HK. High- resolution in situ transcriptomics of Pseudomonas aeruginosa    unveils    genotype    independent patho-phenotypes in cystic fibrosis lungs. Nat Commun. Aug 27 2018;9(1):3459. doi:10.1038/s41467-018-05944-5
45. Balloy V, Varet H, Dillies MA, et al. Normal and Cystic Fibrosis Human Bronchial Epithelial Cells Infected with Pseudomonas aeruginosa Exhibit Distinct Gene Activation Patterns. PloS one. 2015;10(10):e0140979. doi:10.1371/journal.pone.0140979
46. Harrington NE, Littler JL, Harrison F. Transcriptome Analysis of Pseudomonas aeruginosa Biofilm Infection in an Ex Vivo Pig Model of the Cystic Fibrosis Lung. Appl Environ Microbiol. Feb 8 2022;88(3):e0178921. doi:10.1128/AEM.01789-21